View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16435_high_31 (Length: 244)
Name: NF16435_high_31
Description: NF16435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16435_high_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 7 - 147
Target Start/End: Original strand, 43918964 - 43919104
Alignment:
| Q |
7 |
tattagatttggaggtacgtaaatgtaaccattttctagttctgctgaactgaaggaagaatctgaccggttcggttctataagatatatatggactttg |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43918964 |
tattagatttggaggtacgtaaatgtaaccattttctagttctgctgaactgaaggaagaatctgaccggttcggttctataagatatatatggactttg |
43919063 |
T |
 |
| Q |
107 |
agggctttctatcctaaccacttgcgttgattattctcctt |
147 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43919064 |
aggggtttctatcctaaccacttgcgatgattattctcctt |
43919104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 144 - 229
Target Start/End: Complemental strand, 43918841 - 43918756
Alignment:
| Q |
144 |
ccttatctgaatttgaaagtgaaccagttttcagttatgtgttctcaaacatcttcacctcgtttttctttctccaatgatgtttc |
229 |
Q |
| |
|
|||| ||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43918841 |
ccttttctgattttgaaagtgaacctgttttcagttatgtgttctcaaacatcttcacctcgtttttctttctccaatgatgtttc |
43918756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University