View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16435_low_14 (Length: 419)
Name: NF16435_low_14
Description: NF16435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16435_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 141 - 401
Target Start/End: Original strand, 2851059 - 2851328
Alignment:
| Q |
141 |
aaacttcacaagacttttacaatttttgtaaacaacaccattccaacgtagaattttcagaaccggaaaattaaaatcgaaatctcttacgattatcttt |
240 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2851059 |
aaacttcacaagacttttacgatttttgtaaagaacaccattccaacgtagaattttcagaaccggaaaattaaaatcgaaatctcttacgattatcttt |
2851158 |
T |
|
| Q |
241 |
ttcaaatgcagaacttgaagattcatacaagtaaaaacacgaggaggcaattcaactgctaggatattgcgagaaacgactgtaagaaagtagagattct |
340 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2851159 |
ttcaaattcagaacttgaagattcatacaagtaaaaacacgaggaggcaattcaactgctaggatattgcgagaaacgactgtaagaaagtagagattct |
2851258 |
T |
|
| Q |
341 |
cgattc---------ttaaaactaagttaagaatctgattgagacgttttgtgttgcagcttgtagtttt |
401 |
Q |
| |
|
||||| | |||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2851259 |
tgattcgtgagtttttaaaaactaagttaagaatctgattgagacgttttgcattgcagcttgtagtttt |
2851328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University