View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16435_low_27 (Length: 273)
Name: NF16435_low_27
Description: NF16435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16435_low_27 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 14 - 151
Target Start/End: Original strand, 32008295 - 32008431
Alignment:
| Q |
14 |
atatcttaaaagtggataggtgcccttacatggaatgacttttcatccaaacaaatatgtctttctctcttttagttcttggagtcatcaaagtccctcc |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32008295 |
atatcttaaaagtggataggtgcccttacctggaatgacttttcatccaaacaaatatgtctttctctcttttagttcttgtagtcatcaaagtccctcc |
32008394 |
T |
|
| Q |
114 |
aaataaaagacatttatttctcctcttgctcatttccc |
151 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
32008395 |
aaat-aaagacctttatttctcctcttgctcatttccc |
32008431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 216 - 257
Target Start/End: Original strand, 32008512 - 32008553
Alignment:
| Q |
216 |
gctcaagagaaaggaaaaaaggaaactaaagaagcatggaga |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32008512 |
gctcaagagaaaggaaaaaaggaaactaaagaagcatggaga |
32008553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 62 - 110
Target Start/End: Complemental strand, 5775368 - 5775320
Alignment:
| Q |
62 |
aaacaaatatgtctttctctcttttagttcttggagtcatcaaagtccc |
110 |
Q |
| |
|
|||||||||||||||||||||||||| || || ||||||||||||||| |
|
|
| T |
5775368 |
aaacaaatatgtctttctctcttttacttattttagtcatcaaagtccc |
5775320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 52 - 112
Target Start/End: Original strand, 16064635 - 16064695
Alignment:
| Q |
52 |
cttttcatccaaacaaatatgtctttctctcttttagttcttggagtcatcaaagtccctc |
112 |
Q |
| |
|
|||||| || ||||||||| |||||||||||||||| || | ||||||||||||||||| |
|
|
| T |
16064635 |
cttttcgtctaaacaaatacgtctttctctcttttatctcatttagtcatcaaagtccctc |
16064695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University