View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16435_low_29 (Length: 270)
Name: NF16435_low_29
Description: NF16435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16435_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 11 - 252
Target Start/End: Complemental strand, 4363330 - 4363087
Alignment:
| Q |
11 |
cacagaggaattcttcttgaagtgtactgagattgctgcgattgtttgcatttggaaaaccttctctgcaaatcttgtagaagtgtacttctcattttgt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4363330 |
cacagaggaattcttcttgaagtgtactgagattgctgcgattgtttgcatttggaaaaccttctctgcaaatcttgttgaagtgtacttctcattttgt |
4363231 |
T |
|
| Q |
111 |
tgatcaactatcaagtatccatgtttcctgattttactccccttaaagcataatgattggggcttcaataccaagctctagttggacttctgt--gatca |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4363230 |
tgatcaactatcaagtatccatgtttcctgattttactccccttaaagcataatgattggggcttcaataccaagctctagttggacttctgtgagatca |
4363131 |
T |
|
| Q |
209 |
agctctggcatccttcgaatttttcaaaattcacaggattaaca |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4363130 |
agctctggcatccttcgaatttttcaaaattcacaggattaaca |
4363087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 11 - 83
Target Start/End: Complemental strand, 4346901 - 4346829
Alignment:
| Q |
11 |
cacagaggaattcttcttgaagtgtactgagattgctgcgattgtttgcatttggaaaaccttctctgcaaat |
83 |
Q |
| |
|
||||||| ||||||||| |||| |||||| |||||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
4346901 |
cacagagaaattcttctagaagcgtactgggattgctgcgattgtttgcatttggaaagccttctctacaaat |
4346829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University