View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16435_low_37 (Length: 241)
Name: NF16435_low_37
Description: NF16435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16435_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 101 - 214
Target Start/End: Complemental strand, 28597227 - 28597114
Alignment:
| Q |
101 |
ctcatagcacaagatatggtaaaaagaggaaccgaaacaatgacagagatacaaaatggtttaacactactatattagccaataaaataacagttcactg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28597227 |
ctcatagcacaagatatggtaaaaagaggaaccgaagcaatgacagagatacaaaatggtttaacactactatattagccaataaaataacagttcactg |
28597128 |
T |
 |
| Q |
201 |
cagtgcaaaatgca |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
28597127 |
cagtgcaaaatgca |
28597114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University