View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16435_low_40 (Length: 213)
Name: NF16435_low_40
Description: NF16435
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16435_low_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 3 - 192
Target Start/End: Original strand, 47560924 - 47561114
Alignment:
| Q |
3 |
gcttgaatgggtcattgggtagtgaagatctcaaaaacccaaaacctctatgtttctctgtcagatgaaaatcaataaaaattaattgataa-cataaaa |
101 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
47560924 |
gcttgaatgggtcactgggtagtgaagatctcaaaaacccataacctccatgtttctctgtcagatgaaaatcaataaaaattaattgataatcataaaa |
47561023 |
T |
 |
| Q |
102 |
agggtctgtgtaaggttaagatgaaactaattgcagaaccatcaattgtgaattggtttatgaaaattttgaataataaagatgaatatga |
192 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47561024 |
agggtttgtgtgaggttaagatgaaactaattgtagaaccatcaattatgaattggtttatgaaaattttgaataataaagatgaatatga |
47561114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 45 - 170
Target Start/End: Complemental strand, 38406933 - 38406807
Alignment:
| Q |
45 |
aacctctatgtttctctgtcagatgaaaatcaataaaaattaattgataa-cataaaaagggtctgtgtaaggttaagatgaaactaattgcagaaccat |
143 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||||||| ||| ||||||||||| || |||| ||||||||| |||||| ||||||| |
|
|
| T |
38406933 |
aacctccatgtttctctgttagatgaaaatcaataaaaattaattgataaccatgaaaagggtctgcgtgaggtcaagatgaaattaattgtggaaccat |
38406834 |
T |
 |
| Q |
144 |
caattgtgaattggtttatgaaaattt |
170 |
Q |
| |
|
||||| |||||||||||||| |||||| |
|
|
| T |
38406833 |
caattatgaattggtttatggaaattt |
38406807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University