View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_high_10 (Length: 409)
Name: NF16438_high_10
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 18 - 399
Target Start/End: Original strand, 7174733 - 7175114
Alignment:
| Q |
18 |
gaaacaaggatggaaattccaaacacagactgattgcttggtttcgaaattattcaaggctcggtattttccacgtcgtgactacttgggagcgaaacta |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
7174733 |
gaaacaaggatggaaattccaaacacagactaattgcttggtttcgaaattattcaaggctcggtattttccaagtagtgactacttgggagcgaaacta |
7174832 |
T |
 |
| Q |
118 |
ggccataaaccaagttttgtgtggcgcagcatcttcagcgctaagagagtaattcgcgaaggtattcgatggaaaattggaagcggagtgaatataccaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
7174833 |
ggccataaaccaagttttgtgtggcgcagcatcttcagcgctaagagagtaattcgcgaaggtattcgatggaaaattggaatttgagtgaatataccaa |
7174932 |
T |
 |
| Q |
218 |
tatttgatgctccatggctcgaaggtgggaaatgtgtttctggtgaagggcaaaatagcgaggttatccaacatggcaaaattcactcccttatagatca |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7174933 |
tatttgatgctccatggctcgaaggtgggaaatgtgtttctggtgaagggcaaaatagcgaggttatccaacatgccaaaattcactcccttatagatca |
7175032 |
T |
 |
| Q |
318 |
caacttccggtgttggaaccaagatgttattcattgctactttgataacagtacagcccaacaaatcctaaaaacacctttg |
399 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7175033 |
caacttacggtgttggaaccaagatgttattcattgctactttgataacagtacagcccaacaaatcctaaaaacacctttg |
7175114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 55 - 143
Target Start/End: Original strand, 34672334 - 34672422
Alignment:
| Q |
55 |
ttggtttcgaaattattcaaggctcggtattttccacgtcgtgactacttgggagcgaaactaggccataaaccaagttttgtgtggcg |
143 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| | | ||||| ||||| |||||| | ||||| || | ||| ||||||||||| |
|
|
| T |
34672334 |
ttggtttcgaaattattcaaggctcgatattttccccagagcgactatttgggggcgaaattgggccacaacctaagctttgtgtggcg |
34672422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University