View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_high_19 (Length: 343)
Name: NF16438_high_19
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 18 - 319
Target Start/End: Complemental strand, 34962606 - 34962305
Alignment:
| Q |
18 |
atcatcggcagcagcgaggcaaggacggaggagtacaccacttttcttaagagcaggtgaacagagttcaggacgaagttgtcttccaaagacaaggttc |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962606 |
atcatcggcagcggcgaggcaaggacggaggagtacaccacttttcttaagagcaggtgaacagagttcaggacgaagttgtcttccaaagacaaggttc |
34962507 |
T |
 |
| Q |
118 |
ccgccatcagagactgatccgatcgatttcacggagaggatggaagcgccattggtgagatgttcacgatgaagtttgttgagacgagggagggaggaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962506 |
ccgccatcagagactgatccgatcgatttcacggagaggatggaagcgccattggtgagatgttcacgatgaagtttgttgagacgagggagggaggaga |
34962407 |
T |
 |
| Q |
218 |
gtgtggtggcgcgtgacaacactcgtgactccattgggatcaaaatgtgggaagatgataaacaagtagagagtgatatatggatgatgttggtgttggt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34962406 |
gtgtggtggcgcgtgacaacactcgtgactccattgggatcaaaatgtgggaagatgataaacaagtagagagtgatatatggatgatgttggtgttggt |
34962307 |
T |
 |
| Q |
318 |
ac |
319 |
Q |
| |
|
|| |
|
|
| T |
34962306 |
ac |
34962305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University