View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_high_26 (Length: 291)
Name: NF16438_high_26
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_high_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 20 - 283
Target Start/End: Original strand, 33094184 - 33094453
Alignment:
| Q |
20 |
gacataaccctatagtaaatacactttattgatcaaattaacatctccatcatttggccaatgccacttgtaaccccctcataattcacacgtaatcccc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
33094184 |
gacataaccctatagtaaatacactttattgatcaaattaacatctccatcatttggccaatgccacttgtaatcccctcatcattcacacgtaatcccc |
33094283 |
T |
|
| Q |
120 |
cttgccttatacacgcttgctagtacatacatcaataattcattcatcactatacaacggtaaccnnnnnnnngtttctctttatatctcactcacttct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
33094284 |
cttgccttatacacgcttgctagtacatacatcaataattcattcatcactatacaacggtaaccaaaaaaaagtttctctttatatctcactctcttct |
33094383 |
T |
|
| Q |
220 |
ccgtcacttttccaaacctcactttacacaactctct------ttctcacttctcactctcattcatctc |
283 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33094384 |
ccatcacttttccaaacctcactttacacaactctcttctcacttctcacttctcactctcattcatctc |
33094453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University