View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_high_35 (Length: 240)
Name: NF16438_high_35
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_high_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 18 - 224
Target Start/End: Complemental strand, 55300579 - 55300373
Alignment:
| Q |
18 |
ggaagtgggaacaggaagagcaataagacccctatagtatggacttgagtcgtgataacaagaaagggatgagttgtgatgggggtggggatgaggagtg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
55300579 |
ggaagtgggaacaggaagagcaataagacccctatagtatggacttgagtcgtgataacaagaaagggatgagttatgatgggggtggggatgaggagtg |
55300480 |
T |
|
| Q |
118 |
gcccaagaggcatcaatgacaagagagtaatcggtaagacctttgtagtaaggactactgtggggggatgatgaaacgaggataggtcgcagtgatgaag |
217 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
55300479 |
gcccaagaggcatcaatgacaagagaataatcggtaagacctttgtagtaaggactactgtggggggatgatgaaaggaggataggtcgcagtgatgaag |
55300380 |
T |
|
| Q |
218 |
agatatt |
224 |
Q |
| |
|
||||||| |
|
|
| T |
55300379 |
agatatt |
55300373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University