View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_high_43 (Length: 201)
Name: NF16438_high_43
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_high_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 161; Significance: 4e-86; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 161; E-Value: 4e-86
Query Start/End: Original strand, 15 - 183
Target Start/End: Complemental strand, 9032625 - 9032457
Alignment:
| Q |
15 |
aaaatggtacttaggttaaattttgtcttttcacaatatcacgtggcacatgaaatcaattgttgtgattcacatatactccacatcactgtcatgtttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9032625 |
aaaatggtacttaggttaaattttgtctttacacaatatcacgtggcacatgaaatcaattgttgtgattcacatatactccacatcactgtcatgtttt |
9032526 |
T |
 |
| Q |
115 |
cagaaatgaaaattgagtgttataattttgctcgattgttatgataaaatgattacatactagtcctat |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9032525 |
cagaaatgaaaattgagtgttataattttgctcgattgttatgataaaatgattacatacgagtcctat |
9032457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University