View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_low_1 (Length: 609)
Name: NF16438_low_1
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 565; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 565; E-Value: 0
Query Start/End: Original strand, 13 - 593
Target Start/End: Original strand, 43883328 - 43883908
Alignment:
| Q |
13 |
aatattcatggtctcctctacttgtgtccggtgagcatttacaagatcctcttcttcctgaaattacgacacactttaggtaacaacgagcacaaggttt |
112 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43883328 |
aatattcatagtctcctctacttgtgtccggtgagcatttacaagatcctcttcttcctgaaattacgacacactttaggtaacaacgagcacaaggttt |
43883427 |
T |
 |
| Q |
113 |
cttatacgataatcgttatttcagtagccagcaaatcacctgtaagagggcacttaaatcatcctctgaattagcgggtttaggttcagcttttgggagg |
212 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43883428 |
cttatacgataatcattatttcagtagccagcaaatcacctgtaagagggcacttaaatcatcctctgaattagcgggtttaggttcagcttttgggagg |
43883527 |
T |
 |
| Q |
213 |
tccttccatttgactaaaccactaggtttcttcgatttgtcgtctgtcatcgcatatgactccatccttacatttttcttcaacggtggtttcacctgct |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43883528 |
tccttccatttgactaaaccactaggtttcttcgatttgtcatctgtcatcgcatatgactccatccttacatttttcttcaacggtggtttcacctgct |
43883627 |
T |
 |
| Q |
313 |
catagtactcttcaggggggctaaaatcatccccttcattttcatcatgccatgcatcggctgtgtgatcctcatagaccggtgcagtaactgaagataa |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43883628 |
catagtactcttcaggggggctaaaatcatccccttcattttcatcatgccatgcatcggctgtgtgatcctcatagaccggtgcagtaactgaagataa |
43883727 |
T |
 |
| Q |
413 |
gggaaccgtaattgattctttaaggttgaaattcgacgataaaacatccttctttgagttgttcccttttgacaagcttttcaccctggattttcattca |
512 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43883728 |
gggaaccgtaattgattctttaaggttgaaattcgacgataaaacatccttctttgagttgttcccttttgacaagcttttcaccctggattttcattca |
43883827 |
T |
 |
| Q |
513 |
gtttgtaacaatgaaatttgtcatgtcagttgctatattccactaatatatgtgcgtgtgaggtgtggtgttggtaattga |
593 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43883828 |
gtttgtaacaatgaaatttgtcatgtcagttgctatattccactaatatatgtgtgtgtgaggtgtggtgttggtaattga |
43883908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University