View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_low_22 (Length: 328)
Name: NF16438_low_22
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_low_22 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 1 - 313
Target Start/End: Original strand, 32861152 - 32861470
Alignment:
| Q |
1 |
ttagaaattgcacaagctcttaaaccttctttggtgaaccacgaggctcatttttctgaagaaaagaaaaatctgatccagctttggtaagttctttggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
32861152 |
ttagaaattgcacaagctcttaaaccttctttggtgaaccacgaggctcatttttctgaaaaaaagaaaaatctgatccagctttggtaaattctttggt |
32861251 |
T |
 |
| Q |
101 |
gaacctctaagcttttgaaattacaaaatatttagagt--cacgtaggcagtatttaccaatgatttcgtttcaaattagttttaaagttattcttgggg |
198 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861252 |
gaacctctaagctttcgaaattacaaaatatttagagtcacacgtaggcagtatttaccaatgatttcgtttcaaattagttttaaagttattcttgggg |
32861351 |
T |
 |
| Q |
199 |
tgcaggaattatatcatgagt----cacttatactatcttcattccagtgttggtaagttcatgccattttattcatatctgtcttttatttattttgcc |
294 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861352 |
tgcaggaattatatcatgagtaatacacttatactatcttcattccagtgttggtaagttcatgccattttattcatatctgtcttttatttattttgcc |
32861451 |
T |
 |
| Q |
295 |
aactactaagttttatact |
313 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
32861452 |
aactactaagttttatact |
32861470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University