View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_low_26 (Length: 293)
Name: NF16438_low_26
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_low_26 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 33094430 - 33094713
Alignment:
| Q |
1 |
tcacttctcactctcattcatctctagnnnnnnngtcttgaaccttttttgtgaacatagtagcacatcaagtttatgtacaatatatactatatgtata |
100 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33094430 |
tcacttctcactctcattcatctctagaaaaaa-gtcttgaaccttttttgtgaacatagtagcacatcaagtttatgtacaatatatactatatgtata |
33094528 |
T |
|
| Q |
101 |
gaacttgttgattagtcatgaagcttcataaacatatttgcctatttttgtttctctttagtttaatttcaaggtctcaagcatatacattctatgttgg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
33094529 |
gaacttgttgattagtcatgaagcttcataaacatatttgcctatttttgtttctctttagtttaatttcaagttctcaagcatatacattctatgttgg |
33094628 |
T |
|
| Q |
201 |
tggaaaagatggatgggttgtgaatccctcggagagttacagtcaatggacagggaggaataggttccaagtcaatgatattctt |
285 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33094629 |
tggaaaagatggatgggttgtgaatccctcggagagttacagtcaatggacagggaggaataggttccaagtcaatgatattctt |
33094713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University