View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16438_low_27 (Length: 291)

Name: NF16438_low_27
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16438_low_27
NF16438_low_27
[»] chr1 (1 HSPs)
chr1 (19-162)||(5129589-5129731)


Alignment Details
Target: chr1 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 19 - 162
Target Start/End: Complemental strand, 5129731 - 5129589
Alignment:
19 atgaagcaacttccatacaataggtagggttatgaaagttcttgttttaggatgcaaatgatgtcttttctttttattgtaaaatttaatctctgttcat 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| ||||||||||||||||    
5129731 atgaagcaacttccatacaataggtagggttatgaaagttcttgttttaggatgaaaatgatgtcttttcttttt-ttgtaaactttaatctctgttcat 5129633  T
119 tagtcattatctatggttttcggagaatgacttgctaccttgtt 162  Q
    ||||||||||||||||||||| ||||||||||||||||||||||    
5129632 tagtcattatctatggttttcagagaatgacttgctaccttgtt 5129589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University