View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_low_27 (Length: 291)
Name: NF16438_low_27
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_low_27 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 8e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 8e-64
Query Start/End: Original strand, 19 - 162
Target Start/End: Complemental strand, 5129731 - 5129589
Alignment:
| Q |
19 |
atgaagcaacttccatacaataggtagggttatgaaagttcttgttttaggatgcaaatgatgtcttttctttttattgtaaaatttaatctctgttcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
5129731 |
atgaagcaacttccatacaataggtagggttatgaaagttcttgttttaggatgaaaatgatgtcttttcttttt-ttgtaaactttaatctctgttcat |
5129633 |
T |
|
| Q |
119 |
tagtcattatctatggttttcggagaatgacttgctaccttgtt |
162 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5129632 |
tagtcattatctatggttttcagagaatgacttgctaccttgtt |
5129589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University