View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_low_35 (Length: 250)
Name: NF16438_low_35
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_low_35 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 4662566 - 4662802
Alignment:
| Q |
1 |
taaattttttatgttagtaatgtttttgatttattttacagcgaggattgaacttgccgaaattgcttagaggatcattgtttgaagagctttttagaat |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4662566 |
taaattttttatgttagta-tgtttttgatttattttacagcgaggattgaacttgctgaaattgcttagaggatcattgtttgaagagctttttagaat |
4662664 |
T |
|
| Q |
101 |
gactaaatcaaaaaatagcatatttattggcgtaaaaaacttatatgtatctaactgtttgattgccattttctaacacaatgccacaaaatcaatttgt |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4662665 |
gactaaataaaaaaatagcatatttattggcgtaaaaaacttatatgtatctaattgtttgattgccattttctaacacaatg-cacaaaatcaatttgt |
4662763 |
T |
|
| Q |
201 |
gaagtgaggatcacccttcattaataaaaacttgttcat |
239 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4662764 |
gaagtgaggatcacctttcattaataaaaacttgttcat |
4662802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University