View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_low_40 (Length: 240)
Name: NF16438_low_40
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_low_40 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 109 - 240
Target Start/End: Complemental strand, 41715667 - 41715534
Alignment:
| Q |
109 |
agggagctgagttttagggacgcacacaaccggtcttagtaaaattacataagnnnnnnnn-ttagtatttttaaaaatcatttctctctaagaacttgt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41715667 |
agggagctgagttttagggacgcacacaaccggtcttagtaaaattacataagaaaaaaaaattagtatttttaaaaatcatttctctctaagaacttgt |
41715568 |
T |
|
| Q |
208 |
aaaaattgatgaagtg-ttgtataaaatctgagt |
240 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
41715567 |
aaaaattgatgaagtgtttgtataaaatctgagt |
41715534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 18 - 58
Target Start/End: Complemental strand, 41715757 - 41715717
Alignment:
| Q |
18 |
atttatgatctctacccaggagagacgtccaaattatgcta |
58 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41715757 |
atttatgatctctacccaggagagacgtccaaattatgcta |
41715717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University