View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_low_43 (Length: 238)
Name: NF16438_low_43
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 47331772 - 47331994
Alignment:
| Q |
1 |
tttgatggtgaattaattttaaattcatatttgatccctnnnnnnnntagacaaaatgttatgtacaatgtgtcattgatgtgcatctgt-gtattatca |
99 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
47331772 |
tttgatggtggattaattttaaattcatatttgatccctaaaaaaaatagacaaaatgttatgtacaatgtgtcattgatgtgcatccgtcgtattatca |
47331871 |
T |
 |
| Q |
100 |
tttaacatgacacatctacacttctaacaaagttatttgatggatgaaattcaatttaaaagagaaattttttatttcgtaaattcttgatcccaaattg |
199 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
47331872 |
tttaacatgacacatctacacttctaataaagttatttgatgaatgaaattcaatttaaaagagaaattttttatttggtaaattcttgatcccaaattg |
47331971 |
T |
 |
| Q |
200 |
tcacaatttcagaacttctacat |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
47331972 |
tcacaatttcagaacttctacat |
47331994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University