View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16438_low_46 (Length: 208)
Name: NF16438_low_46
Description: NF16438
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16438_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 144; Significance: 7e-76; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 20 - 188
Target Start/End: Original strand, 27849434 - 27849604
Alignment:
| Q |
20 |
aaacctttgcataaagctatagtact--gtgtttgataaaacactactgatgccagggaaggttactctcttttttatcgatactcactcttttgttgga |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||| |
|
|
| T |
27849434 |
aaacctttgcataaagctatagtactttgtgtttgataaaacactactgatgccagggaaggttgctctcttttttatcaatactcactcttttgttgga |
27849533 |
T |
 |
| Q |
118 |
tgaaatcaatgtgaaataaaagagagtgagtgtttgagacgaaagaaaagtgttttttgcactccttatgt |
188 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
27849534 |
tgaaatcaatgtgaaataaaagagagcgagtgtttgagacgaaagaaaattgttttttgcactccttatgt |
27849604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University