View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16439_low_4 (Length: 205)
Name: NF16439_low_4
Description: NF16439
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16439_low_4 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 9 - 205
Target Start/End: Complemental strand, 50631527 - 50631330
Alignment:
| Q |
9 |
agcaaagggagtgaggaagttgaaaattggatttggacctgcagacattaaacttagttttcactagtccaacnnnnnnnn-ctcttttgatgcagaatg |
107 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
50631527 |
agcaaaaggagtgaggaagttgaaaattggatttggacctgcagacattaaacttagttttcactagaccaactttttttttctcttttgatgcagaatg |
50631428 |
T |
|
| Q |
108 |
gaaactgttgttggtgtccatttcctaattgaaagtgattgttttgtcaacttcaattaaatttctttgtcgggtcagagatagtgagaggaagaatc |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
50631427 |
gaaactgttgttggtgtccatttcctaattgaaagtgattgttttgtcaacttcaattaaatttctttgtcgggtcagggatagtgagatgaagaatc |
50631330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University