View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_117 (Length: 247)
Name: NF1643_high_117
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_117 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 44 - 238
Target Start/End: Complemental strand, 3524618 - 3524422
Alignment:
| Q |
44 |
tgataaagggtgaaatcaagaagtggaactgaaaagtgtatggggatttggaggagaaaatcaatgggcttgacgtatatagcaactctagacttcaa-- |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3524618 |
tgataaagggtgaaatcaagaagtggaactgaaaagtgtatggggatttggaggagaaaatcaatgggcttgacgtatatagcaactctagacttcaaat |
3524519 |
T |
|
| Q |
142 |
atatgaataagagggtcttactaaagaggaggtcttaggtttgnnnnnnnntcggatctttggttgcttttgaagagtaaacatagtattatctacc |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3524518 |
atatgaataagagggtcttactaaagaggaggtcttaggtttgaaaaaaaatcggatctttggttgcttttgaagagtaaacatagtattatgtacc |
3524422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University