View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_122 (Length: 243)
Name: NF1643_high_122
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_122 |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0024 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 5 - 243
Target Start/End: Original strand, 4980 - 5218
Alignment:
| Q |
5 |
gcataggttgttgcgtgaattggcgagatgacaaatgtggacctcttgacatttgtgacccaaaaggatccccatatccaggaaaatagttagggttgtt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4980 |
gcataggttgttgcgtgaattggcgagatgacaaatgtggacctcttgacatttgtgacccaaaaggatccccatatccaggaaaatagttagggttgtt |
5079 |
T |
 |
| Q |
105 |
cattgaagactgaaagttgttgtgcatggccatttcatgaccactcgtataaccatatggatcatgatgataactggaataaggaggacctgccaaatgt |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5080 |
cattgaagactgaaagttgttgtgcatggccatttcatgaccactcgtataaccatatggatcatgatgataactggaataaggaggacctgccaaatgt |
5179 |
T |
 |
| Q |
205 |
ttattagggccaaagaattgccttgaggtcgtccggtcc |
243 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
5180 |
ttattagggccaaagaattgcctcgaggtcgtccagtcc |
5218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University