View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_132 (Length: 236)
Name: NF1643_high_132
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_132 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 17 - 236
Target Start/End: Complemental strand, 51670726 - 51670508
Alignment:
| Q |
17 |
acaatgaaggggatgaagtttgaactaagacttcttgcatgctactcaaacccctcaccactacagagtggcgaagtaagttggtgggaatatccacaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
51670726 |
acaatgaaggggatgaagtttgaactaagacttcttgcatgctactcaaacccctcaccactacaaagtggcgaagtaagttggtgggaatatccacaaa |
51670627 |
T |
|
| Q |
117 |
catcccagctcgtctccacttgagaagataaaataatggctttaccctatttgttagaaggggggtagtataggaaagttttataactgaaaatcgtcaa |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51670626 |
catcccagctcgtctccacttgagaagataaaataatggctttaccctatttgttagaag-ggggtaatataggaaagttttataactgaaaatcgtcaa |
51670528 |
T |
|
| Q |
217 |
tcatgtgttggaccacatct |
236 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
51670527 |
tcatatgttggaccacatct |
51670508 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University