View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_136 (Length: 234)
Name: NF1643_high_136
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_136 |
 | |
|
| [»] scaffold0024 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0024 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 5257 - 5475
Alignment:
| Q |
1 |
accacgaggatctggaggaaccatctttgaatcaggatggcccttttctttaggattgttaaccatttcagaagaattgctcagctgctttgataactca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5257 |
accacgaggatctggaggaaccatctttgaatcaggatggcccttttctttaggattgttaaccatttcagaagaattgctcagctgctttgataactca |
5356 |
T |
|
| Q |
101 |
tcaagcttccttagaagctcggctcgatcttgctctaggtgccgaaccctactcataccatccatgtcttcataattactccattgttcaccatgattat |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5357 |
tcaagcttccgtagaagctcggctcgatcttgctctaggtgccgaaccctactcataccatccatgtcttcataattactccattgttcaccatgattat |
5456 |
T |
|
| Q |
201 |
aagaaaatcttgaagttcc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
5457 |
aagaaaatcttgaagttcc |
5475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 6 - 151
Target Start/End: Complemental strand, 48387108 - 48386963
Alignment:
| Q |
6 |
gaggatctggaggaaccatctttgaatcaggatggcccttttctttaggattgttaaccatttcagaagaattgctcagctgctttgataactcatcaag |
105 |
Q |
| |
|
||||||| ||||||| |||| || ||||||| | ||||||||| || ||||| |||| ||||||||| || || ||||| | | ||||||||| || |
|
|
| T |
48387108 |
gaggatcaggaggaatcatcctttcatcaggaagaaacttttctttcgggttgttgaccacttcagaagacttactgagctggtgttttaactcatccag |
48387009 |
T |
|
| Q |
106 |
cttccttagaagctcggctcgatcttgctctaggtgccgaacccta |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
48387008 |
cttccttagaagctcggctcgatcttgctcaaggtgctgaacccta |
48386963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University