View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_19 (Length: 488)
Name: NF1643_high_19
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 1 - 471
Target Start/End: Complemental strand, 35526621 - 35526153
Alignment:
| Q |
1 |
atttatttatgtgattctcttatttattgtctctttgctgttatgattttatgacattggtctgttcatgttttctcttttgttattttctctgatttga |
100 |
Q |
| |
|
||||||||| ||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
35526621 |
atttatttacgtggttctcttatttattgtctctttactgttatgattttatgacattggtctgttcatgtgttctctttggttattttctctgatttga |
35526522 |
T |
 |
| Q |
101 |
attggacagctttggcacannnnnnnattacaactacaaacagctttggtacatttagagtagctttgttatgggaaatttttcatcaaaagtgtttcta |
200 |
Q |
| |
|
|||||||||||||||| || | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35526521 |
attggacagctttggcgcatttttttagtacaactacaaacagctttggtacatttagagtagctttgttatgggaaatttttcatcaaaagtgtttcta |
35526422 |
T |
 |
| Q |
201 |
tttggctggaatttgacttatggatttggaatgtaaaataccaagaatcaaaatggatacagtagatgttaatctggtggttaaatccgttgtattgcgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35526421 |
tttggctggaatttgacttatggatttggaatgtaaaataccaagaatcaaaatggatgcagtagatgttaatctggtggttaaatccgttgtattgcgg |
35526322 |
T |
 |
| Q |
301 |
agactgcgtatgctggaggaattggaagatcctgaaggggttcttccccttgatcctttgttatatggcaacaagttccttcaatctttggcacttagtg |
400 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35526321 |
agactgcgtatgccggaggaattggaggatcctgaaggggttcttccccttgatcctttgt--tatggcaacaagttccttcaatctttggcacttagtg |
35526224 |
T |
 |
| Q |
401 |
ctgcggaattggttgtgacataaaggtgacgaggtcatgggatttccttatttcttcttcattgtgggagc |
471 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35526223 |
ctgcggaattggttgtgacataaaggtgacgaggtcatgggatttccttatttcttcttcattgtgggagc |
35526153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University