View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_29 (Length: 428)
Name: NF1643_high_29
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_29 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0001 (Bit Score: 385; Significance: 0; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 385; E-Value: 0
Query Start/End: Original strand, 17 - 417
Target Start/End: Original strand, 143209 - 143609
Alignment:
| Q |
17 |
actaagttgtcaagtgatttgtaaaagaggatgttctttgttcactacatggcaaatgctcaagaagctaagtataactttaaccatataaatacaatgt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
143209 |
actaagttgtcaagtgatttgtaaaagaggatgttctttgttcactacatggcaaatgctcaagaagctaagtgtaactttaaccatataaatacaatgt |
143308 |
T |
|
| Q |
117 |
tgatgcttcattctcccattctctcaatatagttggaattggaattagcatatctaagatgttcgggggagttttattctagccaaaactaagtggattt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
143309 |
tgatgcttcattctcccattctctcaatatagttggaattggaattagcatatctaagatgttcgggggagttttgttctagccaaaactaagtggattt |
143408 |
T |
|
| Q |
217 |
cccctgtgcttgaggttgacacagaccaaagcactgagaatcttatatgctttaaagtgggtgagagatttacatttgtcggaaatgaactttgagttgg |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
143409 |
cccctgtgcttgaggttgacacagaccaaagcactgagaatcttatatgctttaaagtgggtgagagatttacatttgtcggaaatgaactttgagttgg |
143508 |
T |
|
| Q |
317 |
actcaaagacttttgtggataatctttacgagtgtctcatattttgttgtcattattggtgattgcggacgcattctatatacagatcttgtgaagtctc |
416 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
143509 |
actcaaagactgttgtggataatctttacgagtgtctcatattttgtggtcattattggtgattgcggacgcattctatatacagatcttgtgaagtctc |
143608 |
T |
|
| Q |
417 |
t |
417 |
Q |
| |
|
| |
|
|
| T |
143609 |
t |
143609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University