View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_49 (Length: 366)
Name: NF1643_high_49
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_49 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 20 - 360
Target Start/End: Original strand, 42025832 - 42026170
Alignment:
| Q |
20 |
gcaataacccaagtgcagttgttgtggcacgtgctaaccaaataagtgacattcctaagaaacattcattgtttggtactgtttatgccattgacaatcc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42025832 |
gcaataacccaagtgcagttgttgtggcacgtgctaaccaaacaagtgacattcctaagaaacattcattgtttggtactgtttatgccattgacaatcc |
42025931 |
T |
 |
| Q |
120 |
tcttagggaaggtcctgaagaaacatcaaatgtggttggaaatgcacaagatctttatgtggcatctctagccaaagtgaagatgtgacacttactatgt |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
42025932 |
tcttagggaaggtcctgaagaaacatcaaatgtagttggaaatgcacaaggtctttatgtggcatct--agccagagtgaagatgtgacacttactatgt |
42026029 |
T |
 |
| Q |
220 |
atgttgattatgctttcacctctggtgaattaaatggaagctcctttagtgttctttcgaggaatccggtgagggaaccgacgagggaactcgcggtggt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42026030 |
atgttgattatgctttcacctctggtgaattaaatggaagctcctttagtgttctttcgaggaatccggtgagggaaccgacgagggaactcgcggtggt |
42026129 |
T |
 |
| Q |
320 |
cggaggaagaggaatgtttaggatggccacaggttctgctc |
360 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
42026130 |
cggaggaagaggaaagtttaggatggccactggttttgctc |
42026170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University