View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_61 (Length: 336)
Name: NF1643_high_61
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_61 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 24159789 - 24160042
Alignment:
| Q |
1 |
ccacagttacataaaagatttgtttatgttgttgctcatcttgggataaagaacgcggttccgaaaacgattatgcagttgatgaatgttgaagggttaa |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24159789 |
ccacagttacataaaagatttgttgatgttgttgctcatcttgggataaagaacgcggttccgaaaacgattatgcagttgatgaatgttgaagggttaa |
24159888 |
T |
 |
| Q |
101 |
caagagagaatgttgctagtcatttacagaaatatcgtctttatttgaagagaatgcaaggtctttcaaatgatgctccttcttcttctgatcatctttt |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24159889 |
caagagaaaatgttgctagtcatttacagaaatatcgtctttatttgaagagaatgcaaggtctttcaaatgatgctccttcttcttctgatcatctttt |
24159988 |
T |
 |
| Q |
201 |
tgcttctacacctgtgccacagagtttgcatgaaactgcttctgctaatcattc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24159989 |
tgcttctacacctgtgccacagagtttgcatgaaactgcttctgctaatcattc |
24160042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University