View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_63 (Length: 330)
Name: NF1643_high_63
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_63 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 16 - 317
Target Start/End: Original strand, 34809969 - 34810270
Alignment:
| Q |
16 |
ataacaaccacgttcgttgagatttccgatattgaaatggttgatgaagctatcatcgaaggaaagactaaggttttgtattttgaatcagtctcaaacc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34809969 |
ataacaaccacgttcgttgagatttccgatattgaaatggttgatgaagctatcatcgaaggaaagactaaggttttgtattttgaatcagtctcaaacc |
34810068 |
T |
|
| Q |
116 |
ctactctctcggtggcaaatataccggagttgtgtagggtggcgcatcggaaaggcgtgacggtggtggtggataatacttttactccgatggtgatttc |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34810069 |
ctactctctcggtggcaaatataccggagttgtgtagggtggcgcatcggaaaggtgtgacggtggtggtggataatacttttactccgatggtgatttc |
34810168 |
T |
|
| Q |
216 |
gccggtgaagcttggtgctgatgttgttgttcatagtatctccaagtacatcagtggtggggcagatataattgcaggtttgtttgtctttttgccatgt |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34810169 |
gccggtgaagcttggtgctgatgttgttgttcatagtatctccaagtacatcagtggtggggcagatataattgcaggtttgtttgtctttttgccatgt |
34810268 |
T |
|
| Q |
316 |
tc |
317 |
Q |
| |
|
|| |
|
|
| T |
34810269 |
tc |
34810270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University