View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_65 (Length: 328)
Name: NF1643_high_65
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_65 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 283; Significance: 1e-158; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 283; E-Value: 1e-158
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 24132452 - 24132142
Alignment:
| Q |
1 |
aatcagacctgcaaagaaatgctactaacgcccagaaacttcgtggaaagttttattcagcatatgaaactgaatatagacaacacacctgtgcagtatt |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24132452 |
aatcaaacctgcaaagaaatgctactaacgcccagaaacttcatggaaagtttaattcagcatatgaaactgaacatagacaacacacctgtgcagtatt |
24132353 |
T |
|
| Q |
101 |
ttgcatgcgaggactggcagttttgtaggggagatataagtgggacccgtgtaaccacttttaggaatcagaaatgcatttgtggaaagcgtttgaatgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24132352 |
ttgcatgcgaggactggcagttttgtaggggagatataagtgggacccgtgtaactacttttaggaatcagaaatgcatttgtggaaagcgtttgaatgc |
24132253 |
T |
|
| Q |
201 |
accatctctctttcacgttgtcccgattactgatgtgaatggctttgtgaaggatactgctacttttttaattcgggatgatttttgtgtgatgcctgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24132252 |
accatctctctttcacgttgtcccgattactgatgtgaatggcttttttaaggatactgctacttttttaattcgggatgatttttgtgtgatgcctgat |
24132153 |
T |
|
| Q |
301 |
gatctcgaaac |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
24132152 |
gatctcgaaac |
24132142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 67 - 197
Target Start/End: Complemental strand, 24121955 - 24121825
Alignment:
| Q |
67 |
aaactgaatatagacaacacacctgtgcagtattttgcatgcgaggactggcagttttgtaggggagatataagtgggacccgtgtaaccacttttagga |
166 |
Q |
| |
|
||||||||||| || ||||||||| |||||||||| ||||| |||||||||||| |||||||||| ||| | ||||| |||||||||||||| ||| | |
|
|
| T |
24121955 |
aaactgaatattgatgacacacctgcgcagtattttacatgcaaggactggcagtcttgtaggggatttattaatgggagccgtgtaaccacttatagaa |
24121856 |
T |
|
| Q |
167 |
atcagaaatgcatttgtggaaagcgtttgaa |
197 |
Q |
| |
|
||||||||||||| ||||||| || |||||| |
|
|
| T |
24121855 |
atcagaaatgcatctgtggaaggcttttgaa |
24121825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 237 - 305
Target Start/End: Complemental strand, 24121785 - 24121717
Alignment:
| Q |
237 |
gaatggctttgtgaaggatactgctacttttttaattcgggatgatttttgtgtgatgcctgatgatct |
305 |
Q |
| |
|
|||||||||||| ||||| |||||||||||| |||||||||||||| |||||||||| ||| ||||||| |
|
|
| T |
24121785 |
gaatggctttgttaaggaaactgctacttttataattcgggatgatctttgtgtgattcctaatgatct |
24121717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 239 - 305
Target Start/End: Original strand, 28160888 - 28160954
Alignment:
| Q |
239 |
atggctttgtgaaggatactgctacttttttaattcgggatgatttttgtgtgatgcctgatgatct |
305 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
28160888 |
atggctttgttaaggaaactgctacttttataattcgggatgatctttgtgtgatgcctaatgatct |
28160954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University