View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_70 (Length: 324)
Name: NF1643_high_70
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 1 - 309
Target Start/End: Original strand, 5214273 - 5214581
Alignment:
| Q |
1 |
gtaggatcctatttcaactaaattgaattgaacatttcattatcatgaagaaacatggtaatccgttgaaataatttccaacgggctataattgtttttg |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5214273 |
gtagggtcctatttcaactaaattgaattgaacatttcattatcatgaagaaacatggtaatccgttgaaataattttcaacgggctataattgtttttg |
5214372 |
T |
 |
| Q |
101 |
gtacttggcatgttggagctagatgttgattggcattttctcatcaatgaggtgtcaaaatctatgattggattttacctaaccaataatgtcatttttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5214373 |
gtacttggcatgttggagctagatgttgattggcattttcttatcaatgaggtgtcaaaatctatgattggattttacctaaccaataatgtcatttttg |
5214472 |
T |
 |
| Q |
201 |
tctaacttcaaattgataattagccaaaaaattattcacatggacatgtttcattgctagcatcacaggcgataaatatttgcttccccgacctcggtag |
300 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
5214473 |
tctagcttcaaattgataattagccaaaaaattattcacatggacatgtttcattactagcatcacaggcgataattatttgcttccccgaccttggtag |
5214572 |
T |
 |
| Q |
301 |
cgtcctttg |
309 |
Q |
| |
|
||||||||| |
|
|
| T |
5214573 |
cgtcctttg |
5214581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University