View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_73 (Length: 318)
Name: NF1643_high_73
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_73 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 310; Significance: 1e-175; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 310; E-Value: 1e-175
Query Start/End: Original strand, 1 - 318
Target Start/End: Complemental strand, 35526931 - 35526614
Alignment:
| Q |
1 |
ataatacttagcaactcaagtattgagaagaaggttagcgctgattagaagttgcacttgagtatgttacctttcatgcttgcttgttactggccaaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
35526931 |
ataatacttagcaactcaagtattgagaagaaggttagcgctgattagaagttgcacttgagtatgttacctttcatgcttgcttgttaccggccaaagc |
35526832 |
T |
 |
| Q |
101 |
tagcatccgcaactgcgtgaacatgaacttgtaacatcaggaatgatatagtttgatcttctgctgagcagttcaccacttcacctcacatgaaacctgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35526831 |
tagcatccgcaactgcgtgaacatgaacttgtaacatcaggaatgatatagtttgatcttctgctgagcagttcaccacttcacctcacatgaaacctgc |
35526732 |
T |
 |
| Q |
201 |
tgaacaagtcgcttcttgccttttgccaaattaacaactctcttattgttttatccattcatttatgtggttctgtggtttaatgtagttggtttgagat |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35526731 |
tgaactagtcgcttcttgccttttgccaaattaacaactctcttattgttttatccattcatttatgtggttctgtggtttaatgtagttggtttgagat |
35526632 |
T |
 |
| Q |
301 |
gaatgccaatatttattt |
318 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35526631 |
gaatgccaatatttattt |
35526614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University