View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_86 (Length: 281)
Name: NF1643_high_86
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_86 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 11 - 267
Target Start/End: Complemental strand, 24159816 - 24159560
Alignment:
| Q |
11 |
catcaacaaatcttttatgtaactgtggggtccacactaacctcggcctttttatcgtttccgttgttctaacagctgaatctgcttcagcttccacttc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
24159816 |
catcaacaaatcttttatgtaactgtggggtccacactaacctcggcctttttatcgtttccgttgttctaacagccgaatctgcttcagcttccacttc |
24159717 |
T |
 |
| Q |
111 |
ctctataacagaatctatttttcgatgttttcgtgaatccgaacccgacccgtctcgatcgggttcttcgtcttcttctatatcttctacttcgcaggac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24159716 |
ctctataacagaatctatttttcgatgttttcgtgaatccgaacccgacccgtctcgatcgggttcttcgtcttcttctatatcttctatttcgcaggac |
24159617 |
T |
 |
| Q |
211 |
atagcttgattgatttgattggtgattgttccggagttgcttcggaggagagaaagt |
267 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24159616 |
atagtttgattgatttgattggtgattgttccggagttgcttcggaggagagaaagt |
24159560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University