View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_high_96 (Length: 264)
Name: NF1643_high_96
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_high_96 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 47; Significance: 6e-18; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 198 - 248
Target Start/End: Original strand, 1583128 - 1583178
Alignment:
| Q |
198 |
gttttgtcctttccaaacgcatgcaatcatatgatagacattggtagtatt |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1583128 |
gttttgtcctttccaaacgcatgcaatcatatgatagacattggtaatatt |
1583178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 1582986 - 1583023
Alignment:
| Q |
1 |
tatataaataaatagtttgatagcttttgtcgaatgac |
38 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1582986 |
tatataaataaatagtttgataacttttgtcgaatgac |
1583023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University