View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_100 (Length: 275)
Name: NF1643_low_100
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_100 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 261
Target Start/End: Original strand, 21018838 - 21019091
Alignment:
| Q |
14 |
agacttgtgttttttgtggaaggttggaggaaacggcgttgc------acctcttcttaagttgcgaggtggttacgaggttgtggcaaaaggttatgca |
107 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21018838 |
agacttgtgttttttttggaaggttggaggaaacggcgttgcacttgcacctcttcttacattgcaaggtggttacgaggttgtggcaaaaggttatgca |
21018937 |
T |
|
| Q |
108 |
gtggcttcaatttaactttataacaccgcataatctttgggctcattttctgtgttggtcaaacacggcgtcaactaagaagcttagacatggcttccgg |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
21018938 |
gtggcttcaatttaattttataacaccgcataatctttgggctcattttctgtgttggtcaaacgcggcgtcaactaagaagcttagacatggcttccgg |
21019037 |
T |
|
| Q |
208 |
ttgatttggagtgcgatggtttgggctattttggaagagaaggaatgatattgt |
261 |
Q |
| |
|
|||||||||| ||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21019038 |
ttgatttggaatgcgacggtttgggctattttggaagagaaggaatgatattgt |
21019091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University