View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_116 (Length: 252)
Name: NF1643_low_116
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_116 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 6 - 237
Target Start/End: Original strand, 44114688 - 44114919
Alignment:
| Q |
6 |
cagagacaccaccatgcaccctcttagcacttagcttcttgttgataggtaggttgaaaatggggtcaacttcacaatatgcatcattgatgagttcttg |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44114688 |
cagagacaccaccatgcaccctcttagcacttagcttcttgttgataggtaggttgaaaatggggtcaacttcacaatatgcatcattgatgagttcttg |
44114787 |
T |
 |
| Q |
106 |
gtccacaccatgattaatcacttggaagaaaccatgtttcaaacatgctttcctcacaagctcagcaacacttgcaatagcttcttcatcaccacttttc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44114788 |
gtccacaccatgattaatcacttggaagaaaccatgtttcaaacatgctttcctcacaagctcagcagcacttgcaatagcttcttcatcaccacttttc |
44114887 |
T |
 |
| Q |
206 |
atgacacttaagtctatgagaggttcttttag |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44114888 |
atgacacttaagtctatgagaggttcttttag |
44114919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 110 - 155
Target Start/End: Complemental strand, 40552813 - 40552768
Alignment:
| Q |
110 |
acaccatgattaatcacttggaagaaaccatgtttcaaacatgctt |
155 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| |||||||| |||| |
|
|
| T |
40552813 |
acaccatgattaatgacttggaaaaaaccatggttcaaacaagctt |
40552768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 110 - 150
Target Start/End: Complemental strand, 40581789 - 40581749
Alignment:
| Q |
110 |
acaccatgattaatcacttggaagaaaccatgtttcaaaca |
150 |
Q |
| |
|
|||||||||||||| |||||||| |||||||| |||||||| |
|
|
| T |
40581789 |
acaccatgattaatgacttggaaaaaaccatggttcaaaca |
40581749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University