View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_125 (Length: 248)
Name: NF1643_low_125
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_125 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 18 - 189
Target Start/End: Original strand, 45439087 - 45439258
Alignment:
| Q |
18 |
attccaagcaacaagaatcttctcaatcttataatatagcagcttttggacaagtgtagcaggcttttgacataaagaatgattttaacgggcttcaagg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45439087 |
attccaagcaacaagaatcttctcaatcttataatatagcagcttttggacaagtgtagcaggcttttgacataaagaatgattttaaggggcttcaagg |
45439186 |
T |
 |
| Q |
118 |
aatttcagattgtgtgaccaaatattttgtttttgtatatagtttttcaccaaacatttatgtcagtctctt |
189 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45439187 |
aatttcagattgtgcgaccaaatattttgtttctgtatatagtttttcaccaaacatttatgtcagtctctt |
45439258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 184 - 248
Target Start/End: Original strand, 45439281 - 45439345
Alignment:
| Q |
184 |
tctctttttaatttctctggtgtgggtacaattgcaaaataaggattcttctttctactctcttt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45439281 |
tctctttttaatttctctggtgtgggtacaattgcaaaataaggattcttctttctactctcttt |
45439345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University