View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_126 (Length: 247)
Name: NF1643_low_126
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_126 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 41 - 245
Target Start/End: Original strand, 45439650 - 45439854
Alignment:
| Q |
41 |
ttattactttgcatacaaagaatcttctctttgaacttgcatgatcttctctcaccatactatctttgagagtactcaatatgacaataaagaaagttgt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
45439650 |
ttattactttgcatacaaagaatcttctctttgaacttgcatgatcttctctcaccatactatctttgagagtactcaaaatgacaataaagaaagttgt |
45439749 |
T |
 |
| Q |
141 |
gcaaccaacactttacccaattcaagattctaaaggttggccatcattttcttgacagaggaataatttattcagttagtttaatcataaatgccctttg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45439750 |
gcaaccaacactttacccaattcaagattctaaaggttggccatcattttcttgacagaggaataatttattcagttagtttaatcattaatgccctttg |
45439849 |
T |
 |
| Q |
241 |
ctact |
245 |
Q |
| |
|
|||| |
|
|
| T |
45439850 |
atact |
45439854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University