View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_132 (Length: 245)
Name: NF1643_low_132
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_132 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 44 - 240
Target Start/End: Complemental strand, 29341202 - 29341006
Alignment:
| Q |
44 |
ccttattcttggaaagagagtgtggtatatgtaaagacactcaaacactcaagttagtaagcattgtggatttaggaagtgacttagggtaaaatgtatg |
143 |
Q |
| |
|
|||||||||||||||||||| ||| | ||||||| ||||||||| |||||||||||||||||||||||| ||||| |||| ||| ||||||||| || |
|
|
| T |
29341202 |
ccttattcttggaaagagagggtgacacatgtaaatacactcaaatgctcaagttagtaagcattgtggatgtaggaggtgatttaaggtaaaatgattg |
29341103 |
T |
|
| Q |
144 |
cg-tatatgattcaatgcccttgaattattatttatagtgtaggtttatggttttggtctctattatttatagtgtaggtttaaggtttttgtctctg |
240 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||| |
|
|
| T |
29341102 |
cgttatatgattcaatgcccttgaattattatttatagt-taggtttatggttttggtctctattatttacagtgtaggtttaaggttttggtctctg |
29341006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 72 - 204
Target Start/End: Complemental strand, 29357213 - 29357080
Alignment:
| Q |
72 |
atgtaaagacactcaaacactcaagttagtaag-cattgtggatttaggaagtgacttagggtaaaatgtatgcgtatatgattcaatgcccttgaatta |
170 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |||||||||| ||||| |||| ||||||||||||||||| |||| ||| ||||||||||||| ||| |
|
|
| T |
29357213 |
atgtaaagacactcaaacactcaagtttgtaaaacattgtggatctaggaggtgatttagggtaaaatgtatgtgtatttgagtcaatgcccttgagtta |
29357114 |
T |
|
| Q |
171 |
ttatttatagtgtaggtttatggttttggtctct |
204 |
Q |
| |
|
|||||||||| ||||||||| |||||| |||||| |
|
|
| T |
29357113 |
ttatttatagggtaggtttagggttttagtctct |
29357080 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University