View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_133 (Length: 243)
Name: NF1643_low_133
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_133 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 64 - 224
Target Start/End: Complemental strand, 25988339 - 25988181
Alignment:
| Q |
64 |
ttgaaagacatggtactcagcacatgacacaggtagggaagaccaagaaaagatggaactgtaccatgtaaattttgtgctttccataaatctttatgtg |
163 |
Q |
| |
|
|||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25988339 |
ttgagagacatggtactcagcacatgaca--ggtagggaagaccaagaaaagatggaactgtaccatgtaaattttgggctttccataaatctttatgtt |
25988242 |
T |
|
| Q |
164 |
ggacttttttcttttgacaaagtttctttaactagaaatagcacacccttcttgtttatca |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988241 |
ggacttttttcttttgacaaagtttctttaactagaaatagcacacccttcttgtttatca |
25988181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 25988509 - 25988421
Alignment:
| Q |
1 |
acaataaccattatatcaagatcaaacgatgtatgannnnnnnnnnnnn-aatatttaaggaacttgaaagacatggtactcagcacat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25988509 |
acaataaccattatatcaagatcaaacgatgtatgattttttttctttttaatatttaaggaacttgaaagacatggtactcagcacat |
25988421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University