View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_143 (Length: 236)
Name: NF1643_low_143
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_143 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 28239434 - 28239654
Alignment:
| Q |
1 |
tcctgcaattatgaaccagttggatgtgaaatcctagttgtgatagattgaaacattttagagatacttattttctattcatttctaaattcctctatct |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28239434 |
tcctgcaatgatgaaccagttggatgtgaaatcctagttttgatagattgaaacattttagagatacttattttctattcatttctaaattcctctatct |
28239533 |
T |
|
| Q |
101 |
tcnnnnnnnagttttctttatgatatattcttatatatttgagcaaaatctaactggctttcttaatcatatgttttggtaaatatagatcaatgttgaa |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
28239534 |
tctttttttagttttctttatgatatattcttatatatttgagcaaaatctatctggctttcttaatcatatgttttggtaaatatatatcaatattgaa |
28239633 |
T |
|
| Q |
201 |
gctcttttcaaatggaaatac |
221 |
Q |
| |
|
|||||||| |||||||||||| |
|
|
| T |
28239634 |
gctcttttgaaatggaaatac |
28239654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University