View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_147 (Length: 235)
Name: NF1643_low_147
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_147 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 15 - 223
Target Start/End: Complemental strand, 12636400 - 12636192
Alignment:
| Q |
15 |
acatgcatgaccgaaatcgtctaatgtagtttccgatgtggttacaatgtagacgtacatgtgatttaagatcatatcgcaattgtggtgcaatgttgtt |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
12636400 |
acatgcatgaccgaaatcgtctaatgtagtttccgatgtggttacaatgtagacgtacatgtgatttaagatcctatcgcaattgtggtgcaatgttgtt |
12636301 |
T |
 |
| Q |
115 |
gaggaggctaccacaaacaacaatattaaggtcacaattgcgaatgtgaactaaaattttaatcaatgatcaccttgactatatttattgaagcatgtga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12636300 |
gaggaggctaccacaaacaacaatattaaggtcacaattgcgaatgtgaactaaaattttaatcaatgatcaccttgactatatttattgaagcatgtga |
12636201 |
T |
 |
| Q |
215 |
gagaataat |
223 |
Q |
| |
|
||||||||| |
|
|
| T |
12636200 |
gagaataat |
12636192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University