View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_149 (Length: 234)
Name: NF1643_low_149
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_149 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 14 - 220
Target Start/End: Complemental strand, 6435167 - 6434956
Alignment:
| Q |
14 |
caatgagaaacaagtaacgtagagaaaaagtcattcatccactttatcattacattagtagtgttgatgcatattatcgtgtgtactattcattcaatga |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
6435167 |
caatgagaaacaagtaacgtagagaaaaagtcattcatccactttatcattacattagtagtgttgatgcatattatcgggtgtactattcattcaatga |
6435068 |
T |
|
| Q |
114 |
aagaaagnnnnnnnntcatgccacacacaattg-----taacggctactatcatacaat-ggttttctactatgttaattagatagagatgaaagtgtca |
207 |
Q |
| |
|
|| || ||||||| |||||||||| |||| | ||||||||| |||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6435067 |
aa-aagaaaaaaaaatcatgcctcacacaattgtttaataactgatactatcatgcaatgggttttctactatgttaactagatagagatgaaagtgtca |
6434969 |
T |
|
| Q |
208 |
gttttgttgttag |
220 |
Q |
| |
|
||||||| ||||| |
|
|
| T |
6434968 |
gttttgtggttag |
6434956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University