View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_152 (Length: 232)
Name: NF1643_low_152
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_152 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 23 - 214
Target Start/End: Complemental strand, 46484042 - 46483851
Alignment:
| Q |
23 |
ggcggtacgactaaagatggtttatcttaacaacctcatgcttttctaaatccgaattgagaacgagttgtacaatttgaacaaagatattcatcaacgc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46484042 |
ggcggtacgactaaagatggtttatcttgacaaccccatgcttttctaaatccgaattgagaacgagttgtacaatttgaacaaagatattcatcaacgc |
46483943 |
T |
|
| Q |
123 |
cataaatatcaaagctattcttccaattctatgattcattataaactttcttaatcttaattcttcgattatcaagagaatgagattctgat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46483942 |
cataaatatcaaagctattcttccaattctatgattcattataaactttcttaatcttaattctccgattatcaagagaatgagattctgat |
46483851 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University