View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_39 (Length: 404)
Name: NF1643_low_39
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 276; Significance: 1e-154; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 1 - 288
Target Start/End: Complemental strand, 49547566 - 49547279
Alignment:
| Q |
1 |
aatatcttatctgaacaacaataatatctcttaacggtagtgtccaacgtccatcaccaacaaaatatctctttatccttttaattttccaatggtttct |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49547566 |
aatatcttatctgaactacaataatatctcttaacggtagtgtccaacgtccattaccaacaaaatatctctttatccttttaattttccaatggtttct |
49547467 |
T |
 |
| Q |
101 |
gctctgtgcctaaccccttcatgtcttggtactaaaattttctgtgttcaaacttttgaatgttcaggtctgaacataacaagccatacaaatacgaacc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49547466 |
gctctgtgcctaaccccttcatgtcttggtactaaaattttctgtgttcaaacttctgaatgttcaggtctgaacataacaagccatacaaatacgaacc |
49547367 |
T |
 |
| Q |
201 |
gaaaacatttcagggtcaattatgggttccaaggccctcccacagagaagtattgccttgtcactgcaaaggtacatttatgaccata |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49547366 |
gaaaacatttcagggtcaattatgggttccaaggccctcccacagagaagtattgccttgtcactgcaaaggtacatttatgaccata |
49547279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 312 - 404
Target Start/End: Complemental strand, 49547223 - 49547131
Alignment:
| Q |
312 |
cttccatgaaaaatcgttagcaatgtttgtgttattaagattttgattatttatttatgtaggcttcaaatgacaaccagcaaaacacaaaac |
404 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49547223 |
cttccatgaaaaatagttagcaatgtttgtattattaagcttttgattatttatttatgtaggctacaaatgacaaccagcaaaacacaaaac |
49547131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University