View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_78 (Length: 324)
Name: NF1643_low_78
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_78 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 9 - 262
Target Start/End: Complemental strand, 3557099 - 3556846
Alignment:
| Q |
9 |
gaagaatatggtgaagtttgtgaagtagaagcaatggaaaatagaggaaaggattgtgatgatgtttggtatgatcttccataagagaagagaaggttaa |
108 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3557099 |
gaagaaaatggtgaagtttgtgaagtagaagcaatggaaaatagaggaaaggattgtgatgatgtttggtatgatcttccataagagaagagaaggttaa |
3557000 |
T |
 |
| Q |
109 |
aaaagattcaactttgaagtttgagagacaatgtgggagagaatagtggagagtgggagagagaaatgtgcattaaattttgaagtgaagcttagcatgt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3556999 |
aaaagattcaactttgaagtttgagagacaatgtgggagagaatagtggagagtgggagagagaaatgtgcattaaattttgaagtgaagcttaacatgt |
3556900 |
T |
 |
| Q |
209 |
tacgttctgtttgttttggttcattcatgcaaattttctgttttgaatcttttg |
262 |
Q |
| |
|
|| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3556899 |
tatgttctgtttgttttggttcattcatgcaacttttctgttttgaatcttttg |
3556846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University