View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_92 (Length: 290)
Name: NF1643_low_92
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_92 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 72 - 282
Target Start/End: Original strand, 7152541 - 7152754
Alignment:
| Q |
72 |
cttagtttggtctcatca---ctcatgtattagctataaggagatataatggtttttgtgtttccatgtcactgaaggcaagctagcatatgttatctta |
168 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7152541 |
cttagtttggtctcatcagtactcatgtattagctatagggagatataatgctttttgtgtttccatgtcactgaaggcaagctagcatatgttatctta |
7152640 |
T |
 |
| Q |
169 |
cagaaatgg-agaacttggaacgacaaaatgtaattgttattagtttggaacgaaataaggtagataaaactccattccttgacttcgatgagaaacaaa |
267 |
Q |
| |
|
||||||||| |||||||||||||||| |||||||||| ||| | ||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
7152641 |
cagaaatggaagaacttggaacgacataatgtaattg-tatcaatttggaacgaaataaggtagagaaaactccattccttgacttctatgagaaacaaa |
7152739 |
T |
 |
| Q |
268 |
ttatcgttttctttt |
282 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7152740 |
ttatcgttttctttt |
7152754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University