View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1643_low_97 (Length: 279)
Name: NF1643_low_97
Description: NF1643
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1643_low_97 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 139; Significance: 9e-73; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 9e-73
Query Start/End: Original strand, 98 - 260
Target Start/End: Original strand, 40021383 - 40021545
Alignment:
| Q |
98 |
tgaaatttcttattaattgttgaattactatctacaaatagtatgcagggtttagggtgttacaaatatcttcaaagtcaatgtaaaagagcaactacag |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
40021383 |
tgaaatttcttattaattgttgaattactatctacaaatagtatgcagggtttagggtgttacatatatcttcaaaaccaatgtaaaagagcaactacag |
40021482 |
T |
|
| Q |
198 |
aagcatgcagagggattctaaagagtcgaaaccaaattatcatttcccgattggaggtcatta |
260 |
Q |
| |
|
||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40021483 |
aagcatggagagggattccaaatagtcgaaaccaaattatcatttcccgattggaggtcatta |
40021545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 2 - 56
Target Start/End: Original strand, 40021319 - 40021373
Alignment:
| Q |
2 |
tttatgttgctgagacttattttcactgcaatttgatattatatgatgatttttt |
56 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40021319 |
tttatgttgctcagacttattttcactacaatttgatattatatgatgatttttt |
40021373 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 81 - 124
Target Start/End: Complemental strand, 27505092 - 27505050
Alignment:
| Q |
81 |
gttgaagagtaacatcttgaaatttcttattaattgttgaatta |
124 |
Q |
| |
|
|||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
27505092 |
gttgaagagtaacatcttgatatttctt-ttaattgttgaatta |
27505050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 78 - 160
Target Start/End: Complemental strand, 11262088 - 11262005
Alignment:
| Q |
78 |
aatgttgaagagtaacatcttgaaat-ttcttattaattgttgaattactatctacaaatagtatgcagggtttagggtgttac |
160 |
Q |
| |
|
||||||||||||||||| | |||||| ||||||||||||||||||||| ||| || |||||||||||||||||||||||||||| |
|
|
| T |
11262088 |
aatgttgaagagtaacaacctgaaatgttcttattaattgttgaattattatttaaaaatagtatgcagggtttagggtgttac |
11262005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University