View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16441_low_12 (Length: 255)
Name: NF16441_low_12
Description: NF16441
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16441_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 4257663 - 4257428
Alignment:
| Q |
1 |
tctgtggatcaactctgtcaaatattcctctccaacttcctccaaagattttcccacttcatgtttaacaaacccctctgctatccattgccgaatcaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4257663 |
tctgtggatcaactctgtcaaatattcctctccaacttcctccaaagattttcccacttcatgtttaacaaacccctctgctatccattgccgaatcaac |
4257564 |
T |
 |
| Q |
101 |
cttgaactccgaattgagtaatcttctgggtatataccaaaatacaagacgcatgacttcaaataatgtggcaagtcatcataactcatgcctaaaattc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4257563 |
cttgaactccgaattgagtaatcttctgggtatataccaaaatacaagacacatgacttcaaataatgtggcaagtcatcataactcatgcctaaaattc |
4257464 |
T |
 |
| Q |
201 |
ttgttatattagctaaatgtggattatggtctaact |
236 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |
|
|
| T |
4257463 |
ttgttatattagctaaatgtggattacggtctaact |
4257428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 5 - 99
Target Start/End: Original strand, 22620448 - 22620542
Alignment:
| Q |
5 |
tggatcaactctgtcaaatattcctctccaacttcctccaaagattttcccacttcatgtttaacaaacccctctgctatccattgccgaatcaa |
99 |
Q |
| |
|
|||||||||||||| || ||| | ||| ||||||| ||||||| || ||| ||| | ||| |||||||| || |||||||||||||||||||| |
|
|
| T |
22620448 |
tggatcaactctgttaagtatccttctgcaacttcttccaaagtattccccctttcttcttttacaaacccttcagctatccattgccgaatcaa |
22620542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University