View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16443_low_15 (Length: 222)
Name: NF16443_low_15
Description: NF16443
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16443_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 32 - 205
Target Start/End: Complemental strand, 40080515 - 40080346
Alignment:
| Q |
32 |
cggtcgatgttgaaagatagaggaaaaggaaaagacacagacaaaaacaaatacgttcttctgtggcagaggtcattgctgatttcggatagagaggaag |
131 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| |
|
|
| T |
40080515 |
cggtcgatgttgaaagattgaggaaaaggaaaagacacagacaaaaacaaatacgttcttctgtggcagaggccattgctgatttcggaaagagaggaag |
40080416 |
T |
|
| Q |
132 |
gtatgagcagtatcagtatattcagtatatgaacagcatgcatatggttatataagatattaataagcgtaatc |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
40080415 |
gtatgagcagtatcagtatattcagtatatgaaca----gcatatggttatataagatattaataagcgtaatc |
40080346 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 37 - 116
Target Start/End: Complemental strand, 40086504 - 40086425
Alignment:
| Q |
37 |
gatgttgaaagatagaggaaaaggaaaagacacagacaaaaacaaatacgttcttctgtggcagaggtcattgctgattt |
116 |
Q |
| |
|
|||||||| |||| |||||| ||||| | ||| ||| | |||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
40086504 |
gatgttgagagatggaggaagaggaagaaacaaagaaacaaacaaatgcgttcttctgtggcagaggccattgctgattt |
40086425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University